In vitro antagonism of Trichoderma asperellum against
Colletotrichum gloeosporioides, Curvularia lunata, and
Fusarium oxysporum
Antagonismo
in vitro de Trichoderma asperellum
contra
Colletotrichum gloeosporioides, Curvularia
lunata, y Fusarium oxysporum
Johana Ramírez-Olier1a, Juan Trujillo-Salazar1b,
Víctor Osorio-Echeverri2, Margarita Jaramillo-Ciro1c, Liliana Botero-Botero1d
1Grupo de Investigaciones en
Biodiversidad, Biotecnología y Bioingeniería (Grinbio),
Facultad de Ingenierías,
Universidad de Medellín, Colombia. Email: a jpramirez@udem.edu.com , b juantrujillos@live.com , c mmjaramillo@udem.com , d lbotero@udem.edu.co
2 Biociencias, Colegio Mayor de Antioquia, Colombia. Email: victor.osorio@colmayor.edu.co
Abstract
The objective of this study was to evaluate the antagonistic effects of two native isolates of Trichoderma asperellum (GRB-HA1 and GRB-HA2) against the phytopathogenic fungi Colletotrichum gloeosporioides, Curvularia lunata, and Fusarium oxysporum, with the aim of developing biological control agents to replace the use of chemical fungicides. An antagonism assay was performed under in vitro conditions using the dual culture method, and the percentage inhibition of radial growth (PIRG) and the degree of mycoparasitism (grade 0–4) were evaluated after 10 days of culture. Results show that both isolates resulted in 100% PIRG and grade 4 mycoparasitism in dual cultures against Colletotrichum gloeosporioides and Curvularia lunata although GRB-HA1 led to 70% PIRG and grade 3 mycoparasitism and GRB-HA2 led to 84% PIRG and grade four mycoparasitism against F. oxysporum. Thus, these native T. asperellum isolates show potential for the biological control of diseases caused by phytophathogenic fungi.
Keywords: antagonistic fungi; biological control; biopesticides.
Resumen
El objetivo
de este estudio fue evaluar los efectos antagónicos de dos aislados nativos de Trichoderma asperellum
(GRB-HA1 y GRB-HA2) contra los hongos fitopatógenos Colletotrichum gloeosporioides,
Curvularia lunata y Fusarium
oxysporum, para desarrollar agentes de control
biológico para sustituir el uso de fungicidas químicos. Se determinó el
antagonismo en condiciones in vitro utilizando el método de cultivo
dual, y se evaluaron el porcentaje de inhibición del crecimiento radial (PIRG)
y el grado de micoparasitismo (grado 0–4). Se
encontró que ambos aislamientos resultaron en 100 % PIRG y micoparasitismo
de grado 4 en cultivos duales contra Colletotrichum
gloeosporioides y Curvularia
lunata, aunque GRB-HA1 condujo a 70 % de PIRG y
grado 3, y GRB-HA2 condujo a 84 % de PIRG y grado 4 de micoparasitismo
contra F. oxysporum. Por tanto, estos
aislamientos nativos de T.
asperellum muestran potencial para el control biológico de enfermedades causadas
por hongos fitofatogénicos
Phytopathogenic fungi affect the
production of a wide variety of vegetables, cereals and fruits through their
effects on both pre- and post-harvest crops [1]. Furthermore, they do not only reduce
agricultural production in developing countries like Colombia, where it can
result in losses of 5%–25%, but also reduce it in developed countries like the
United States of America, where losses of 5%–10% can occur [2]. Fusarium oxysporum
is considered an important phytopathogenic fungus
that affects more than 100 plant species, including a wide variety of crops
such as banana (Musa spp.) and corn (Zea
mays) [3], [4], [5]. In addition, the fungus Colletotrichum
gloeosporioides causes anthracnosis in fruits
such as avocado (Persea americana),
tomato (Solanum lycopersicum)
and papaya (Carica papaya) [6], [7] and
Curvularia lunata
causes foliar spots in several important tropical food crops, including corn
and rice (Oryza sativa) [8], [9],
[10]. Traditionally, these fungal agricultural diseases have been
controlled and prevented using highly toxic synthetic, non-biodegradable
pesticides derived from tin and mercury, which have negative environmental and
human health impacts [11], [12], [13]. However, there has recently been an
increased interest in the use of soil conditioning products to control plant
fungal diseases, including antagonistic fungi from the genus Trichoderma. These fungi naturally occur in soils that favor the
development of plants and are capable of inhibiting the growth of other fungi,
making them an excellent alternative to chemical products for decreasing the
impacts of phytopathogenic fungi [14], [15],
[16]. Many studies have shown that fungi in the genus Trichoderma have the potential for controlling C. Gloeosporioides, C. Lunata
and F. Oxysporum. However, there is still a large amount of uncertainty around
their effectiveness, with levels of control ranging from 50% to 85% [17], [18],
largely depending on the characteristics of the microorganisms and the place
from which they were isolated [19], [20], [21]. Therefore, the aim of this
study was to evaluate the antagonist activity of two new isolates of Trichoderma asperellum
as a strategy for controlling the phytopathogenic
fungi C. Gloeosporioides, C. Lunata,
and F. Oxysporum. Two antagonist fungi (GRB-HA1 and GRB-HA2) were isolated
from colonies of leaf-cutting ants (Atta cephalotes)
between March and April 2015. It was found that these fungi negatively affected
the growth of the symbiont fungus Leucoagaricus
gongylophorus under laboratory conditions during
experiments conducted by the Biodiversity, Biotechnology and Bioengineering
Research Group (GRINBIO, in Spanish) at the Universidad de Medellin (Medellin,
Colombia). Moreover, a commercial antagonistic strain of Trichoderma harzianum
(trbio) was donated by Biotropical S.A.S
(Antioquia-Colombia) to use as a positive control. The phytopathogenic
fungi C. Gloeosporioides, C. Lunata,
and F. Oxysporum were donated by Safer S.A.S.
(Antioquia-Colombia). All the fungi (antagonistic and phytopathogenic)
were maintained in the laboratory at the Universidad de Medellin under dark
conditions at 25°C ± 2°C in potato dextrose agar (PDA) [22]. The identities of the isolates GRB-HA1 and GRB-HA2 were
confirmed by DNA sequencing and sequence analysis. DNA was extracted from each
isolate using Norgen’s Plant/Fungi DNA Isolation Kit
according to the manufacturer’s instructions (Cat. 26200), and the DNA
concentration was estimated by measuring the absorbance at 260 nm (Nanodrop). Polymerase chain reaction (PCR) amplification of
the internal transcribed spacer (ITS) was then performed using the primers ITS1
(5′ TCCGTAGGTGAACCTGCGG 3′) and ITS4 (5′
TCCTCCGCTTATTGATATGC 3′) for both isolates, although amplification of the
beta-tubulin gene was performed using the primers ASP_Bt2a (5′
GGTAACCAAATCGGTGCTGCTTTC 3′) and ASP_Bt2b (5′ ACCCTCAGTGTAGTGACCCTTGGC 3′) for the GRB-HA1 isolate. Sequencing was performed using
the Sanger/capillary method for both strands, and the obtained sequences were
debugged and assembled using the programs Cap3 and ebiox
version 1.5.1. The sequences were then compared to ITS sequences from the GenBank database
using BLAST (http://www.ncbi.nlm.nih.gov/). A phylogenetic analysis was
conducted using the package MEGA version 6.0, and the neighbor-joining and maximum-likelihood
methods were used to construct phylogenetic trees with 1,000 bootstrap
replicates. The antagonism assay was performed on PDA in Petri dishes
using the dual culture method proposed by [22]. Mycelial plugs (5 mm diameter)
were obtained from cultures of the fungal antagonists (GRB-HA1, GRBHA2, and trbio) and pathogens (C. Gloeosporioide,
C. Lunata, and F. Oxysporum)
after 5 days of incubation at 25°C ± 2°C under dark conditions, and pairs of antagonists
and pathogens were placed 6 cm apart on the same Petri dish (Figure 1). The
radial growth (RG) of the fungi was then measured using a vernier
caliper after 10 days of incubation at 25°C ± 2°C under dark conditions. Dual
confrontation tests were performed for each antagonistic fungus (the native
isolates GRB-HA1 and GRB-HA2 and the commercial isolate trbio)
with each pathogenic fungus (C. Gloeosporioides, C
lunata, and F. Oxysporum). PDA medium
inoculated only with the test pathogens served as controls to determine the
capacity of growth of the pathogenic fungi. Thus, there were 12 treatments in
total, each of which was performed in triplicate. The percentage inhibition of radial growth (PIRG) was
calculated after 12 days of culture using Ecuation
(1): Where KR represents the distance (in mm) from the point of
inoculation to the colony margin on dishes that were inoculated only with the
test pathogens (i.e., the controls), and R1 represents the distance of fungal
growth from the point of inoculation to the colony margin on the treated dishes
in the direction of the antagonist [23]. PIRG was categorized from 0 to 4 using
a growth inhibition category (GIC) scale, where 0 = no growth inhibition, 1 =
1%–25% growth inhibition, 2 = 26%–50% growth inhibition, 3 = 51%–75% growth
inhibition and 4 = 76%–100% growth inhibition (table 1). The results were analyzed by variance analysis with the statgraphics Centurion 2015 software, and significant
differences were estimated using the least significant difference (LSD) test.
For all analyses, p < 0.05 was considered significant. 3.1. Characterization and
molecular The GRB-HA1 isolate was grouped with the species T. Asperellum with 90% bootstrap support, and there was a
distance of only 0.006 between their sequences in the distance matrix (figure
2). . Similarly, the GRB-HA2 isolate was grouped with T.
Asperellum with 94% bootstrap support, and there
was a distance of 0.002 between their sequences (figura3) (table2). It was found that both strains of T. Asperellum
(GRBHA1 and GRB-HA2) had a higher antagonistic capacity than the commercial
strain of T. Harzianum (trbio).
There was no significant difference between the activities
of GRB-HA1 and GRB-HA2 in dual cultures with C. Gloeosporioides
and C. Lunata (PIRG = 100% ± 0%), but both had higher
PIRG values than the commercial strain trbio (PIRG =
49% ± 7% for C. Gloeosporoides and 53% ± 6%
for C. Lunata) (figure 4). Furthermore, both
GRB- HA1 and GRB-HA2 exhibited a higher degree of mycoparasitism of C. Gloeosporioides
and C. Lunata (grade 4) than the commercial trbio
isolate (grade 3) (table 2). [17] previously obtained lower antagonism values of 61%–65%
PIRG and mycoparasitism grade 4 against C. Gloeosporioides and argued that this showed that the
microorganism they tested had potential for controlling this phytopathogenic fungus. Furthermore, several studies have
recently evaluated the antagonistic power of Trichoderma spp.
Against C. Lunata, with [10] achieving 55%
PIRG with T. Aureoviride. This is similar to the value found in the present study with the
commercial trbio isolate but below the values
obtained with the native isolates GRB-HA1 and GRB-HA2. Thus, both native
isolates of T. Asperellum (GRB-HA1 and
GRB-HA2) show great promise for controlling C. Gloeosporioides
and C. Lunata. However, these findings will
need to be corroborated under field conditions. In contrast with these findings, there was no significant
difference in the control capability of trbio and the
GRBHA1 and GRB-HA2 isolates against F. Oxysporum
(figure 4). The highest PIRG against F. Oxysporum
was obtained using GRB-HA2 (84% ± 2%), followed by the commercial trbio isolate (70% ± 9%), and finally GRBHA1 (67% ± 12%):
the degree of mycoparasitism was categorized as stage
4 for the GRB-HA2 isolate and stage 3 for the GRB-HA1 and trbio
isolates ( table 3). These findings are similar to
those obtained by [24], who reported that three T. Harzianum
isolates (Tr 16, and Tr08) resulted in 78% and 68%
radial growth inhibition of F. Solani, respectively. The antagonist capabilities of the native Trichoderma isolates GRB-HA1 and GRB-HA2 vary depending on
the microorganism they are trying to control. The native Trichoderma isolates
GRB-HA1 and GRBHA2 can completely inhibit the growth of Colletotrichum
gloeosporioides and Curvularia
lunata The GRB-HA2 isolate is most effective in
controlling Colletotrichum gloeosporioides, Curvularia lunata, and F. Oxysporum.
The native Trichoderma isolates
GRB-HA1 and GRBHA2 have potential for the biological control of diseases caused
by Colletotrichum gloeosporioides,
Curvularia lunata, and F.
Oxysporum. We thank the Universidad de Medellín
and the Faculty of Health Science of Institución Universitaria Colegio Mayor de
Antioquia for its institutional support. We are grateful to the GRINBIO human
team for their active participation in the experimental development of the
project, as well as to the laboratory center and the Engineering Research
Center (in Spanish CEIN) of the Universidad de Medellín
for its administrative support. Thanks are also due to the Department of
Science, Technology and Innovation in Colombia (in Spanish COLCIENCIAS) for their
economic support. [1] G. Juárez-Becerra, M. Sosa-Morales, A.
López-Malo, “Hongos fitopatógenos de alta importancia
económica: descripción y métodos de control”, TSIA, vol. 4, no. 2,
p.14-23, 2010. [2] “Deterioro poscosecha
de las frutas y Hortalizas frescas por hongos y bacterias,” FHIA informa, San
Pedro Sula, Cortés, Hond., Dic. 2007 [En línea].
Disponible en: http://www.fhia.org.hn/ dowloads/fhia_ informa/fhiainfdic2007.pdf [3] J. Gonzáles-Cardenas,
J. Maruri-Carcía, A. GonzálesAcosta,
“Evaluación de diferentes concentraciones de Trichoderma
asperillum contra Fusarium oxysporum
agente causal de pudrición de plántulas en papaya (Carica
papaya L.) En Tuxpan, Veracruz, México,” Rev. UDO Agrícola, vol. 5, pp.
45-47, 2005. [4] C. Suárez, R. Fernández, N. Valero, R.
Gámez, A. Páez, “Antagonismo in vitro de Trichoderma harzianum [5] W, Flores-Bazauri, J.
Chico-Ruíz, L. Cerna-Rebaza, “Actividad antagónica in vitro de Clonostachys rosea sobre Fusarium axysporum,
Alternaria solani y Botrytis cinerea”, Rev. REBIOL,
vol. 35, no. 1, pp. 34-42, 2015. [6] E. S. R., J. M. G., and N. M., “La Infección de
Colletotrichum gloeosporioides
(Penz.) Penz. y Sacc. en [7] L.
Machado, S. Matsumoto, G. Cuzzuol, L. Oliveira,
“Influence of laboratory cultivation on species of Rhodophyta
physiological evaluations and antifungal activity against phytopathogens”,
Rev. Cienc. Agron., vol. 45, no. 1, pp. 52-61,
2014. [8] F. Varón, G. Sarria, Enfermedades del maíz y
su manejo. Palmira: ICA Fenalce, 2007. [9] D. Sardinha, D. Silva
et al., “Fungos e nematóides fitopatogênicos
associados ao cultivo de
flores tropicais em São
Luís – MA”, Summa Phytopathologica,
vol. 38, no. 2, pp. 159-162, 2012. doi:
10.1590/S010054052012000200010. [10] R. Sneha, K. Satya-Prasad, “Antagonistic activity of Trichoderma aureoviride
against Fusarium solani and
Curvularia clavata,” Journ. Of Intern. Acad. Res. For Multidisciplinary,
vol. 2, no. 10, pp. 422-427, 2014. [11] G. C. Papavizas, “Trichoderma and Gliocladium: Biology, Ecology, and Potential for
Biocontrol,” Annu. Rev. Phytopathol., vol. 23, no. 1, pp. 23–54, 1985. [12] M. H. Badii, J.L. Abreu, “Control biológico
una forma sustentable de control de plagas”, Daena,
vol 1, pp. 82-90, 2006. [13] M. Verma, S. K. Brar, R. D. Tyagi, R. Y. Surampalli, and J.
R. Valéro, “Antagonistic fungi, Trichoderma
spp.: Panoply of biological control,” Biochem.
Eng. J., vol. 37, no. 1, pp. 1–20, 2007. [14] G. E. Harman,
“Overview of Mechanisms and Uses of Trichoderma
spp.,” Phytopathology, vol. 96, no. 2, pp. 190–194, Feb. 2006. doi:
10.1094/PHYTO-96-0190 [15] F. Matarese, S. Sarrocco, S. Gruber,
V. SeidlSeiboth, and G. Vannacci,
“Biocontrol of Fusarium head blight:
interactions between Trichoderma and mycotoxigenic Fusarium,” Microbiology,
vol. 158, no. 1, pp. 98–106,
2012. doi: 10.1099/mic.0.052639-0
[16]
B. Martínez, Y. Obret, S. Pérez, Y. Reyes, “Antagonismo in vitro de cepas
de Trichoderma asperellum
frente a Sarocladium oryzae
(Sawada) W. Gams & D. Hawksworth.” Rev. Protección Veg.,
vol.29, no. 2, pp. 106-111, 2014. [17]
V. Gaviria-Hernández,
L. F. Patiño-Hoyos, y A. Saldarriaga-Cardona, “Evaluación in vitro de
fungicidas comerciales para el control de Colletotrichum
spp., en mora de castill,” RCTA,
vol. 14, no. 1, pp. 67-75, 2013. [18] M.T. Aktar,
K.S. Hossain, M.A. Bashar, “Antagonistic potential of rhizosphere fungi against
leaf spot and fruit rot pathogens brinjal,” Bangladesh
Journ. of Botany, vol. 43, no. 2, pp. 213-217,
2014. [19]
B. K. Mishra, R. K. Mishra, R. C. Mishra, A. K. Tiwari, R. S. Yadav, and
A. Dikshit, “Biocontrol efficacy of Trichoderma viride isolates
against fungal plant pathogens causing disease in Vigna
radiata L,” Arch. Appl. Sci. Res., vol. 3, no.
2, pp. 361–369, 2011. [20]
J. A. O., S. A. O., J. O., and J. P. K., “Assessment of trichoderma isolates for virulence efficacy on fusarium oxysporum f. sp. phaseoli,” Trop. Subtrop. Agroecosystems, vol. 13, pp. 99–107, 2011. [21]
T. G. Kim and G. R. Knudsen, “Relationship between the biocontrol fungus
Trichoderma harzianum and
the phytopathogenic fungus Fusarium
solani f.sp. pisi,” Appl. Soil Ecol.,
vol. 68, pp. 57–60, 2013.
[22]
N. J. Fokkema, “Fungal antagonisms in the phyllosphere,” Ann. Appl. Biol., vol. 89, no. 1, pp.
115–119. doi: 10.1111/j.1744-7348.1978.tb02582.x [23]
L. Korsten, E. S. De
Jager, E. E.
De Villiers, “Evaluation of bacterial epiphytes isolated from
avocado leaf and fruit surfaces for biocontrol of avocado postharvest
diseases,” Plant Disease, vol. 79, n.° 11, pp. 1149-1156, 1995. [24]
S. A. Wani et al., “Incidence of Fusarium wilt of chilli (Capsicum
annum L.) in Kashmir valley and its management by Trichoderma
spp,” MYCOPATH, vol. 12, no. 1, pp. 1–8, 2014.
1. Introduction
2. Materials and
methods
2.1.
Microorganisms
2.2.
Characterization and molecular identification
2.3. Antagonism
assay
3. Results and discussion
identification of
GRB-HA1 and GRB-HA2
3.2. Antagonistic
analysis
4. Conclusions
Acknowledgements
References